5G-modified-4

Catalog #	Pkg Size	Price(USD)	Quantity	Buy this product
R-M2-11061	100nmol	625.00	- +	+ Add to cart

Product description

5G-modified-4 is a dual modified long G cluster highly stable functional oligonucleotide probe with clear sequence and simultaneous 2-O-methylribose modification and thiophosphate backbone modification on the entire chain. It is the most classic dual modified model probe in clinical grade antisense nucleic acid drug development.

Appearance	N/A
Molecular Weight	N/A
Solubility	N/A
Molecular formula	N/A
Sequence	5GGGGGTGTAGCTCATAGCCG3-2-O-methyl phosphorothioate oligomers
Storage	-20℃, protected from light and moisture
Transportation	4-25℃ temperature for up to 1-3 weeks
Stability	6 months

Document

msds of 5G-modified-4